Skip to Content

Genotyping Protocols

Each genotyping reaction is a little bit different, requiring slightly different conditions for optimum PCR amplification.

The following worksheets show the various conditions that have been optimized for genotyping different mouse lines. Typically, more than one mouse is genotyped at a time. It is easiest to prepare a Master Mix (MM) that contains everything but the DNA for the PCR reactions.

The worksheets show the amount for one reaction.

  • If you have five mice to genotype, then multiply the µL amounts for each reagent by nine:
    • Five genotyping reactions
    • One known positive control
    • One negative control with wild type mouse DNA
    • One negative control with water
    • One extra to compensate for pipetting errors

  • Pipet 1 µL of mouse DNA (See the protocol for extracting DNA from mouse tails and yolk sacs.) into the bottom of PCR tubes – one tube per reaction
  • Then, aliquot the well-mixed MM into each tube
  • For 15 µL reactions, it is not necessary to vortex the reactions and spin them down before putting them into the PCR machine
  • For 50 µL reactions, it is advisable to mix each tube thoroughly and spin them down before putting them in the PCR machine
  • Primers are used at 10 µM concentration. dNTPs are used at 10 mM concentration
  • The H2O is endonuclease-free
  • The buffer and MgCl2 used are supplied with the different types of Taq polymerase. These are used without dilution
  • All values in the worksheets are in µL
  • The MM Volume is the amount to aliquot into each reaction tube

Gcn5 wt/flox

1X MM

 

  • H2O: 9.65 µL
  • Buffer: 1.5 µL
  • MgCl2: 0.45 µL
  • DMSO: 0.6 µL
  • Taq,
    Denville Chroma: 0.9 µL
  • dNTPs: 0.3 µL
  • Primer 1
    WL20-EJ: 0.3 µL
  • Primer 2
    WL21-3-EJ: 0.3 µL
  • MM Volume: 14 µL
  • DNA: 1 µL

X 9

Five Mice to Genotype

  • H2O: 86.85 µL
  • Buffer: 13.5 µL
  • MgCl2: 4.05 µL
  • DMSO: 5.4 µL
  • Taq,
    Denville Chroma: 8.1 µL
  • dNTPs: 2.7 µL
  • Primer 1
    WL20-EJ: 2.7 µL
  • Primer 2
    WL21-3-EJ: 2.7 µL
  • MM Volume: 126 µL
  • DNA: 1 µL

Gcn5 ∆3-18 and Flox(neo)

Gcn5 ∆3-18

1X MM

  • H2O: 9.65 µL
  • Buffer: 1.5 µL
  • MgCl2: 0.45 µL
  • DMSO: 0.6 µL
  • Taq,
    Denville Chroma: 0.9 µL
  • dNTPs: 0.3 µL
  • Primer 1
    WL20-EJ: 0.3 µL
  • Primer 2
    WL23-EJ: 0.3 µL
  • MM Volume: 14 µL
  • DNA: 1 µL

Gcn5 Flox(neo)

1X MM

  • H2O: 9.65 µL
  • Buffer: 1.5 µL
  • MgCl2: 0.45 µL
  • DMSO: 0.6 µL
  • Taq,
    Denville Chroma: 0.9 µL
  • dNTPs: 0.3 µL
  • Primer 1
    WL20-EJ: 0.3 µL
  • Primer 2
    WL21-2-EJ: 0.3 µL
  • MM Volume: 14 µL
  • DNA: 1 µL

Gcn5 HAT1 wt and mut (exon 12)

Gcn5 HAT1 wt
(exon 12)

1X MM

  • H2O: 9.65 µL
  • Buffer: 1.5 µL
  • MgCl2: 0.45 µL
  • DMSO: 0.6 µL
  • Taq,
    Denville Chroma: 0.9 µL
  • dNTPs: 0.3 µL
  • Primer 1
    JZ-HAT1-wt-F: 0.3 µL
  • Primer 2
    JZ-HAT1-R: 0.3 µL
  • MM Volume: 14 µL
  • DNA: 1 µL

Gcn5 HAT1 mut
(exon 12)

1X MM

  • H2O: 9.65 µL
  • Buffer: 1.5 µL
  • MgCl2: 0.45 µL
  • DMSO: 0.6 µL
  • Taq,
    Denville Chroma: 0.9 µL
  • dNTPs: 0.3 µL
  • Primer 1
    JZ-HAT1-m-F: 0.3 µL
  • Primer 2
    JZ-HAT1-R: 0.3 µL
  • MM Volume: 14 µL
  • DNA: 1 µL

Gcn5 HAT2 wt and mut (exon 13)

Gcn5 HAT2 wt
(exon 13)

1X MM

  • H2O: 9.65 µL
  • Buffer: 1.5 µL
  • MgCl2: 0.45 µL
  • DMSO: 0.6 µL
  • Taq,
    Denville Chroma: 0.9 µL
  • dNTPs: 0.3 µL
  • Primer 1
    JZ-HAT2-wt-R: 0.3 µL
  • Primer 2
    JZ-HAT2-F: 0.3 µL
  • MM Volume: 14 µL
  • DNA: 1 µL

Gnc5 HAT2 mut
(exon 13)

1X MM

  • H2O: 9.65 µL
  • Buffer: 1.5 µL
  • MgCl2: 0.45 µL
  • DMSO: 0.6 µL
  • Taq,
    Denville Chroma: 0.9 µL
  • dNTPs: 0.3 µL
  • Primer 1
    JZ-HAT2-m-R: 0.3 µL
  • Primer 2
    JZ-HAT2-F: 0.3 µL
  • MM Volume: 14 µL
  • DNA: 1 µL

Gcn5 Null

1X MM

  • H2O: 9.65 µL
  • Buffer: 1.5 µL
  • MgCl2: 0.45 µL
  • DMSO: 0.6 µL
  • Taq,
    Denville Chroma: 0.9 µL
  • dNTPs: 0.3 µL
  • Primer 1
    Gcn5Df: 0.3 µL
  • Primer 2
    Gcn5Dr: 0.3 µL
  • MM Volume: 14 µL
  • DNA: 1 µL

PCAF - WT and Null

PCAF - WT

1X MM

  • H2O: 3.35 µL
  • Buffer D: 7.5 µL
  • Taq
    Epicentre FailSafe: 0.15 µL
  • Primer 1
    PCAF-WT-F
    : 1.5 µL
  • Primer 2
    PCAF-WT-R
    : 1.5 µL
  • MM Volume: 14 µL
  • DNA: 1 µL

PCAF - Null

1X MM

  • H2O: 3.35 µL
  • Buffer D: 7.5 µL
  • Taq
    Epicentre FailSafe: 0.15 µL
  • Primer 1
    PCAF-null-F
    : 1.5 µL
  • Primer 2
    PCAF-null-R
    : 1.5 µL
  • MM Volume: 14 µL
  • DNA: 1 µL

PCP2-Cre and P300

PCP2-Cre

1X MM

  • H2O: 4.29 µL
  • Buffer: 1.2 µL
  • MgCl2: 0.96 µL
  • DMSO: 1.0 µL
  • Taq,
    Denville Chroma: 0.9 µL
  • dNTPs: 0.25 µL
  • Primer 1
    Cre-For: 0.6 µL
  • Primer 2
    Cre-Rev: 0.6 µL
  • Primer 3
    (IL2 internal control)
    Pcp2Con-f
    : 0.6 µL
  • Primer 4
    (IL2 internal control)
    Pcp2Con-R: 0.6 µL
  • MM Volume: 11 µL
  • DNA: 1 µL

P300

1X MM

  • H2O: 9.45 µL
  • Buffer: 1.5 µL
  • MgCl2: 0.45 µL
  • DMSO: 0.6 µL
  • Taq,
    Denville Chroma: 0.9 µL
  • dNTPs: 0.3 µL
  • Primer 1
    CS-1: 0.3 µL
  • Primer 2
    PGK-1: 0.3 µL
  • Primer 3
    (Gcn5 internal control)
    WL20-EJ
    : 0.3 µL
  • Primer 4
    (Gcn5 internal control)
    WL21-3-EJ: 0.3 µL
  • MM Volume: 14 µL
  • DNA: 1 µL

Band Sizes

This chart shows the expected band sizes for each set of primers:

Genotype

  • GCN5 wt
  • GCN5 ∆3-18
  • GCN5 Flox
  • GCN5 Flox(neo)
  • GCN5 HAT 1-wt
  • GCN5 HAT 1-mut
  • GCN5 HAT 2-wt
  • GCN5 HAT 2-mut
  • GCN5 Null
  • P300
     
  • PCP2-Cre
     
  • PCAF-wt
  • PCAF-null

Band Size, bp

  • 210
  • 240
  • 310
  • 410
  • 360
  • 360
  • 370
  • 370
  • 450
  • 400 bp
    210-bp internal control (Gcn5)
  • 100 bp
    320-bp internal control (IL2)
  • 175
  • 390
GenePrimer NameSequence
Gcn5 WTWL20-EJCACAGAGCTTCTTGGAGACC
Gcn5 WTW 21-3-EJGGCTTGATTCCTGTACCTCC
Gcn5 Δ3-18WL23-EJATAGTAGCGACTGCGCAACC
Gcn5 Flox(neo)WL21-2-EJCTGTGCCTTCTAGTTGCCAG
Gcn5 HAT1 WT
exon 12
JZ-HAT1-wt-FTTCCCACTCAGGGCTTCACGGA
Gcn5 HAT1
exon 12
JZ-HAT1-RCTCTCACAGTAGACCAGGCTGG
Gcn5 HAT1 mut
exon 12
JZ-HAT1-m-FCCCACTCAGGGCTTCACGCG
Gcn5 WT exon 13JZ-HAT2-wt-RTGAAGTAGCCAATGGCGTACTCGT
Gcn5 exon 13JZ-HAT2-FGTGGTCCACTGACCTCAGACTG
Gen5 mut exon 13JZ-HAT2-m-RTGAAGTAGCCAATGGCGTACTCTG
Gcn5 nullGcn5DfTCACTATCTCGGATGGCTT
Gcn5 nullGcn5DrCCTCTTCGCTATTACGCCAG
PCAF WTPCAF-WT-FAAGCTGCTCACGTTTCTCACTTGG
PCAF WTPCAF-WT-RGGGTAAGCTCTCACCTTGAATAGG
PCAF nullPCAF-Null-FGGATGTGGAATGTGCGAG
PCAF nullPCAF-Null-RTCCAACAGCCTCTCTAGCCT
IL2 WTPcp2Con-fCTAGGCCACAGAATTGAAAGATCT
IL2 WTPcp2Con-rGTAGGTGGAAATTCTAGCATCATCC
Pcp2Cre-ForGCGGTCTGGCAGTAAAAACTATC
Pcp2Cre-RevGTGAAACAGCATTGCTGTCACTT
p300CS-1CATGCTCACAAGTGCCAGC
p300PGK-1CTGCACGAGACTAGTGAGACG

 

All the above protocols were optimized for the following PCR program:

Cycles115251Hold
Temp
(°C)
95946572945072724
Time5:00:30:301:30:30:301:3010:00Hold

© 2014 The University of Texas MD Anderson Cancer Center